Stem-loop sequence nvi-mir-1

Accession MI0014753
Description Nasonia vitripennis miR-1 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cc      cu            c    uuc     -  gc 
  gagcgu  guuccgugcuuc uuac   ccaua gu  a
  ||||||  |||||||||||| ||||   ||||| ||  c
  cucgcg  cgagguaugaag aaug   gguau ca  g
gu      -c            a    uaa     g  gu 
Get sequence
Genome context
Coordinates (Nvit_2.0) Overlapping transcripts
chr2: 11310810-11310890 [-]
intergenic
Database links

Mature sequence nvi-miR-1

Accession MIMAT0015692
Sequence

50 - 

uggaauguaaagaaguauggag

 - 71

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).