Stem-loop sequence nvi-mir-1

AccessionMI0014753 (change log)
DescriptionNasonia vitripennis miR-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   cc      cu            c    uuc     -  gc 
5'   gagcgu  guuccgugcuuc uuac   ccaua gu  a
     ||||||  |||||||||||| ||||   ||||| ||  c
3'   cucgcg  cgagguaugaag aaug   gguau ca  g
   gu      -c            a    uaa     g  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr2: 10362116-10362196 [-]
intergenic
Database links

Mature sequence nvi-miR-1

Accession MIMAT0015692
Sequence

50 - 

uggaauguaaagaaguauggag

 - 71

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).