Stem-loop sequence nvi-mir-315

AccessionMI0014750 (change log)
DescriptionNasonia vitripennis miR-315 stem-loop
Gene family MIPF0000141; mir-315
Stem-loop
          -a  c  u            a       ----   a 
5' gcucucu  ug uu ugauuguugcuc gaaagcc    ucg u
   |||||||  || || |||||||||||| |||||||    |||  
3' ugagagg  ac aa acuaauaacggg cuuucgg    agc a
          gc  u  u            -       ucau   u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr3: 11744183-11744264 [-]
intergenic
Database links

Mature sequence nvi-miR-315

Accession MIMAT0015689
Sequence

12 - 

uuuugauuguugcucagaaagc

 - 33

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).