Stem-loop sequence nvi-mir-124

AccessionMI0014749 (change log)
DescriptionNasonia vitripennis miR-124 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   u    cuu            ggcuuccaugugccaag 
5'  gcuc   gcguucacugcg                 u
    ||||   ||||||||||||                 u
3'  cgag   cguaaguggcgc                 u
   g    aac            acggaauacuuaaaaau 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr4: 2984091-2984167 [+]
intergenic
Database links

Mature sequence nvi-miR-124

Accession MIMAT0015688
Sequence

51 - 

uaaggcacgcggugaaugccaag

 - 73

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).