Stem-loop sequence nvi-mir-124

AccessionMI0014749 (change log)
DescriptionNasonia vitripennis miR-124 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. However these results are controversial since other reports have described a role for miR-124 during neuronal differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u    cuu            ggcuuccaugugccaag 
5'  gcuc   gcguucacugcg                 u
    ||||   ||||||||||||                 u
3'  cgag   cguaaguggcgc                 u
   g    aac            acggaauacuuaaaaau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr4: 2984091-2984167 [+]
intergenic
Database links

Mature sequence nvi-miR-124

Accession MIMAT0015688
Sequence

51 - 

uaaggcacgcggugaaugccaag

 - 73

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).