Stem-loop sequence nvi-mir-305

AccessionMI0014747 (change log)
DescriptionNasonia vitripennis miR-305 stem-loop
Gene family MIPF0000158; mir-305
Stem-loop
   g     ---ug     u     ua     u    ug  cu    au 
5'  gaggc     caugu aauug  cuuca cagg  cu  ggug  u
    |||||     ||||| |||||  ||||| ||||  ||  ||||  u
3'  uuccg     guaua uuaac  gaggu gucc  gg  ccau  u
   -     uguua     c     gc     u    gu  -c    ag 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr4: 1482355-1482444 [+]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-305
nvi-mir-275chr4: 1482167-1482260 [+]
nvi-mir-305chr4: 1482355-1482444 [+]
Database links

Mature sequence nvi-miR-305

Accession MIMAT0015686
Sequence

16 - 

auuguacuucaucaggugcucug

 - 38

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).