Stem-loop sequence nvi-mir-34

AccessionMI0014743 (change log)
DescriptionNasonia vitripennis miR-34 stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cggggaa       g    uug       g u    u        -ag u 
5'        gcgaccg cgug   gcagugu g uagc gguugugu   c u
          ||||||| ||||   ||||||| | |||| ||||||||   | a
3'        cgcuggc guau   cgucaca c aucg ccagcacg   g u
   --cuuag       a    uaa       g u    -        aaa a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr4: 7973903-7974001 [-]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-34
nvi-mir-277chr4: 7978315-7978401 [-]
nvi-mir-34chr4: 7973903-7974001 [-]
Database links

Mature sequence nvi-miR-34

Accession MIMAT0015682
Sequence

21 - 

uggcagugugguuagcugguug

 - 42

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).