Stem-loop sequence nvi-mir-34

AccessionMI0014743 (change log)
DescriptionNasonia vitripennis miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   cggggaa       g    uug       g u    u        -ag u 
5'        gcgaccg cgug   gcagugu g uagc gguugugu   c u
          ||||||| ||||   ||||||| | |||| ||||||||   | a
3'        cgcuggc guau   cgucaca c aucg ccagcacg   g u
   --cuuag       a    uaa       g u    -        aaa a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr4: 7973903-7974001 [-]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-34
nvi-mir-277chr4: 7978315-7978401 [-]
nvi-mir-34chr4: 7973903-7974001 [-]
Database links

Mature sequence nvi-miR-34

Accession MIMAT0015682
Sequence

21 - 

uggcagugugguuagcugguug

 - 42

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).