Stem-loop sequence nvi-mir-10

AccessionMI0014737 (change log)
DescriptionNasonia vitripennis miR-10 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   ccc   ---ua    u      cu   -  g    u           ---  a 
5'    agu     augc cuacau  acc cu uaga ccgaauuuguu   ug a
      |||     |||| ||||||  ||| || |||| |||||||||||   ||  
3'    ucg     uacg ggugug  ugg ga aucu ggcuuaaacag   ac g
   -ca   uaaca    u      uu   a  g    u           cgg  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr4: 6871398-6871497 [+]
intergenic
Database links

Mature sequence nvi-miR-10

Accession MIMAT0015676
Sequence

22 - 

acccuguagauccgaauuugu

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).