Stem-loop sequence nvi-mir-iab-4

AccessionMI0014736 (change log)
DescriptionNasonia vitripennis miR-iab-4 stem-loop
Gene family MIPF0000151; mir-iab-4
Stem-loop
   c     -            u    -  u  gu u 
5'  ccugu acguauacugaa guau cc ga  g a
    ||||| |||||||||||| |||| || ||  | u
3'  ggaca ugcauaugacuu caua gg cu  c u
   a     a            c    u  c  gu u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr4: 6271855-6271923 [-]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-iab-4
nvi-mir-iab-4chr4: 6271855-6271923 [-]
nvi-mir-iab-8chr4: 6271855-6271923 [+]
Database links

Mature sequence nvi-miR-iab-4

Accession MIMAT0015675
Sequence

42 - 

cgguauaccuucaguauacguaac

 - 65

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).