Stem-loop sequence nvi-mir-iab-8

AccessionMI0014735 (change log)
Previous IDsnvi-mir-iab-4as
DescriptionNasonia vitripennis miR-iab-8 stem-loop
Gene family MIPF0000854; mir-iab-8
Stem-loop
   u     u            g    a  g  caga 
5'  ccugu acguauacugaa guau cc ga    a
    ||||| |||||||||||| |||| || ||    a
3'  ggaca ugcauaugacuu caua gg cu    u
   g     -            a    -  a  caca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr4: 6271855-6271923 [+]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-iab-8
nvi-mir-iab-4chr4: 6271855-6271923 [-]
nvi-mir-iab-8chr4: 6271855-6271923 [+]
Database links

Mature sequence nvi-miR-iab-8

Accession MIMAT0015674
Previous IDsnvi-miR-iab-4as
Sequence

6 - 

uuacguauacugaagguauaccg

 - 28

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).