Stem-loop sequence nvi-mir-283

AccessionMI0014730 (change log)
DescriptionNasonia vitripennis miR-283 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   u  --  -u     ca    gu aa        u  u         aua uu 
5'  gc  ug  ccagu  cgua  c  auaucagc gg aauucuggg   c  a
    ||  ||  |||||  ||||  |  |||||||| || |||||||||   |  u
3'  cg  gc  gguca  gcau  g  uauggucg uc uuaggaccc   g  u
   c  cu  uc     -a    ug cc        u  -         gac ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
GL340882.1: 829662-829763 [+]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-283
nvi-mir-283GL340882.1: 829662-829763 [+]
nvi-mir-3477GL340882.1: 830357-830448 [+]
nvi-mir-12GL340882.1: 830969-831052 [+]
Database links

Mature sequence nvi-miR-283

Accession MIMAT0015669
Sequence

21 - 

aaauaucagcugguaauucu

 - 40

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).