Stem-loop sequence nvi-mir-92a

AccessionMI0014729 (change log)
DescriptionNasonia vitripennis miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   gu   u     aaaa         a   c    g       ucguaau  u 
5'   uug ugcau    gauaggucg gau ggug caauguu       gg u
     ||| |||||    ||||||||| ||| |||| |||||||       ||  
3'   aau acgua    cuauccggc cug ucac guuauaa       cc u
   uu   c     -agg         c   u    -       ----cuc  u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
GL341020.1: 410729-410826 [+]
intergenic
Database links

Mature sequence nvi-miR-92a

Accession MIMAT0015668
Sequence

63 - 

auugcacuugucccggccuau

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).