Stem-loop sequence nvi-mir-2b

AccessionMI0014728 (change log)
DescriptionNasonia vitripennis miR-2b stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       -     u   c        -             -  gcu 
5' ucgg cuguu cgc cgucagag ugguugugauaug gu   a
   |||| ||||| ||| |||||||| ||||||||||||| ||    
3' agcu gacaa gcg guaguuuc accgacacuauac ca   u
       u     u   u        g             g  agu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr1: 8080812-8080896 [+]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-2b
nvi-mir-71chr1: 8079015-8079116 [+]
nvi-mir-2cchr1: 8079186-8079287 [+]
nvi-mir-13achr1: 8079335-8079437 [+]
nvi-mir-13bchr1: 8079595-8079686 [+]
nvi-mir-2achr1: 8079789-8079881 [+]
nvi-mir-2bchr1: 8080812-8080896 [+]
Database links

Mature sequence nvi-miR-2b

Accession MIMAT0015667
Sequence

51 - 

uaucacagccagcuuugaugugc

 - 73

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).