Stem-loop sequence nvi-mir-13b

AccessionMI0014726 (change log)
DescriptionNasonia vitripennis miR-13b stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   ----a    -gc       -        -u        gc   -uu  c 
5'      gagc   gauccga ucgucaaa  ugguugug  gug   gu u
        ||||   ||||||| ||||||||  ||||||||  |||   ||  
3'      uucg   cuagguu agcaguuu  accgacac  uac   ua a
   uagcg    gua       g        uu        ua   uuu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr1: 8079595-8079686 [+]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-13b
nvi-mir-71chr1: 8079015-8079116 [+]
nvi-mir-2cchr1: 8079186-8079287 [+]
nvi-mir-13achr1: 8079335-8079437 [+]
nvi-mir-13bchr1: 8079595-8079686 [+]
nvi-mir-2achr1: 8079789-8079881 [+]
nvi-mir-2bchr1: 8080812-8080896 [+]
Database links

Mature sequence nvi-miR-13b

Accession MIMAT0015665
Sequence

52 - 

uaucacagccauuuuugacgagu

 - 74

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).