Stem-loop sequence nvi-mir-13a

AccessionMI0014725 (change log)
DescriptionNasonia vitripennis miR-13a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   gagcagagacauggaac        u    -ua       u         a   ucuc 
5'                  uuuugcgg ccga   caucaaa ugguugugg aug    g
                    |||||||| ||||   ||||||| ||||||||| |||    u
3'                  aagaugcc gguu   guaguuu accgacacu uac    c
   ---------------uc        c    cga       u         a   cuuu 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr1: 8079335-8079437 [+]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-13a
nvi-mir-71chr1: 8079015-8079116 [+]
nvi-mir-2cchr1: 8079186-8079287 [+]
nvi-mir-13achr1: 8079335-8079437 [+]
nvi-mir-13bchr1: 8079595-8079686 [+]
nvi-mir-2achr1: 8079789-8079881 [+]
nvi-mir-2bchr1: 8080812-8080896 [+]
Database links

Mature sequence nvi-miR-13a

Accession MIMAT0015664
Sequence

67 - 

uaucacagccauuuugaugag

 - 87

Get sequence
Evidence not experimental

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).