Stem-loop sequence nvi-mir-2c

AccessionMI0014724 (change log)
DescriptionNasonia vitripennis miR-2c stem-loop
Gene family MIPF0000049; mir-2
   ggagacaagagagcgaguggcaugcuuuuac              u  c    ggc 
5'                                caucaaagcugguu gu auag   u
                                  |||||||||||||| || ||||    
3'                                guaguuucgaccga ca uauc   u
   -----------uacggccuguguuaaaacga              -  c    agc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr1: 8079186-8079287 [+]
Clustered miRNAs
< 10kb from nvi-mir-2c
nvi-mir-71chr1: 8079015-8079116 [+]
nvi-mir-2cchr1: 8079186-8079287 [+]
nvi-mir-13achr1: 8079335-8079437 [+]
nvi-mir-13bchr1: 8079595-8079686 [+]
nvi-mir-2achr1: 8079789-8079881 [+]
nvi-mir-2bchr1: 8080812-8080896 [+]
Database links

Mature sequence nvi-miR-2c

Accession MIMAT0015663

63 - 


 - 85

Get sequence
Evidence experimental; 454 [1]


PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).