Stem-loop sequence nvi-mir-7

AccessionMI0014720 (change log)
DescriptionNasonia vitripennis miR-7 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   u       g     u   a  c          g    uc   uu 
5'  gagcguc uugua gga ga uagugauuuu uugu  uac  a
    ||||||| ||||| ||| || |||||||||| ||||  |||  a
3'  cucgcag aacau ccu cu aucacuaagg aaca  aug  g
   g       a     -   a  a          -    --   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
GL341044.1: 2108577-2108663 [+]
intergenic
Database links

Mature sequence nvi-miR-7

Accession MIMAT0015659
Sequence

15 - 

uggaagacuagugauuuuguugu

 - 37

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).