Stem-loop sequence nvi-mir-281

AccessionMI0014719 (change log)
DescriptionNasonia vitripennis miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   --aagaaaa     g   -             -ua     c      a g  g 
5'          aagcg acg cuauaaagagagc   uccau gacagu u gu a
            ||||| ||| |||||||||||||   ||||| |||||| | || u
3'          uucgc ugc gguguuucucucg   aggua cuguca a ua a
   gcaacauaa     -   a             uuc     -      c g  g 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
GL341044.1: 692904-693006 [-]
intergenic
Database links

Mature sequence nvi-miR-281

Accession MIMAT0015658
Sequence

61 - 

ugucauggacuugcucucuuugu

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).