Stem-loop sequence nvi-mir-281

AccessionMI0014719 (change log)
DescriptionNasonia vitripennis miR-281 stem-loop
Gene family MIPF0000087; mir-46
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-46/mir-47/mir-281_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, mir-46 (MI0000017) and mir-47 (MI0000018) are microRNA expressed in C. elegans from related hairpin precursor sequences. The predicted hairpin precursor sequences for Drosophila mir-281 (MI0000366, MI0000370) are also related and, hence, belong to this family. The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequences are expressed from the 3' arms of the hairpin precursors.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --aagaaaa     g   -             -ua     c      a g  g 
5'          aagcg acg cuauaaagagagc   uccau gacagu u gu a
            ||||| ||| |||||||||||||   ||||| |||||| | || u
3'          uucgc ugc gguguuucucucg   aggua cuguca a ua a
   gcaacauaa     -   a             uuc     -      c g  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
GL341044.1: 692904-693006 [-]
intergenic
Database links

Mature sequence nvi-miR-281

Accession MIMAT0015658
Sequence

61 - 

ugucauggacuugcucucuuugu

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).