Stem-loop sequence nvi-mir-29b

AccessionMI0014717 (change log)
DescriptionNasonia vitripennis miR-29b stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   acacgaagaau      a c  a        c     -  c        -   acc 
5'            uaagau g ag gguacuga uucgg ug gugcuggg guu   g
              |||||| | || |||||||| ||||| || |||||||| |||    
3'            auucug c uc ucaugacu aaguu ac cacgaucc cga   a
   ----------g      - -  a        a     u  -        g   acu 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr1: 29761752-29761850 [-]
intergenic
Database links

Mature sequence nvi-miR-29b

Accession MIMAT0015656
Sequence

66 - 

uagcaccauuugaaaucagu

 - 85

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).