Stem-loop sequence nvi-mir-14

AccessionMI0014716 (change log)
DescriptionNasonia vitripennis miR-14 stem-loop
Gene family MIPF0000182; mir-14
Stem-loop
   cuuuuua      c            u      cu    u    a g   ucc 
5'        uucgcu ggucaguggggg gagaaa  ggcu ggcu u uac   c
          |||||| |||||||||||| ||||||  |||| |||| | |||    
3'        gagcgg ccgguuauccuc cucuuu  cuga cuga a gug   c
   ----uaa      c            u      uu    -    c g   uua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
chr1: 24530682-24530784 [+]
intergenic
Database links

Mature sequence nvi-miR-14

Accession MIMAT0015655
Sequence

67 - 

ucagucuuuuucucucuccua

 - 87

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).