Stem-loop sequence mmu-mir-3471-2

AccessionMI0014701 (change log)
Symbol MGI:Mir3471-2
DescriptionMus musculus miR-3471-2 stem-loop
Gene family MIPF0001053; mir-3471
Literature search

1 open access papers mention mmu-mir-3471-2
(1 sentences)

Stem-loop
   --   aa    --    u    ---   -aa ug     --ca       aa   g 
5'   aga  ugcc  ucca gaga   ucc   c  uaagg    uuuuccc  uua u
     |||  ||||  |||| ||||   |||   |  |||||    |||||||  |||  
3'   ucu  augg  gggu cucu   agg   g  guucc    aaaaggg  aau g
   gu   -g    uc    -    aac   gug gu     ccgg       ga   a 
Get sequence
Deep sequencing
8364 reads, 208 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 3537090-3537191 [+]
intergenic
Database links

Mature sequence mmu-miR-3471

Accession MIMAT0015642
Sequence

14 - 

ugagauccaacuguaaggcauu

 - 35

Get sequence
Deep sequencing15731 reads, 72 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).