Stem-loop sequence mmu-mir-3471-1

AccessionMI0014699 (change log)
Symbol MGI:Mir3471-1
DescriptionMus musculus miR-3471-1 stem-loop
Gene family MIPF0001053; mir-3471
Literature search

2 open access papers mention mmu-mir-3471-1
(2 sentences)

Stem-loop
   --       -c    ----g    --       -u    ucc     -ua  -    uuccuca      -  ug 
5'   aaaggag  uuca     uuga  gccucca  gaga   aacug   ag gcau       auuagu gc  u
     |||||||  ||||     ||||  |||||||  ||||   |||||   || ||||       |||||| ||   
3'   uuuccuu  gagu     gauu  uggaggu  uucu   uugac   uc cgua       ugaucg cg  u
   au       uu    aucga    ua       uu    ---     cug  u    -----ug      u  ua 
Get sequence
Deep sequencing
7832 reads, 269 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 10845500-10845630 [-]
intergenic
Database links

Mature sequence mmu-miR-3471

Accession MIMAT0015642
Sequence

25 - 

ugagauccaacuguaaggcauu

 - 46

Get sequence
Deep sequencing15731 reads, 72 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).