Stem-loop sequence ath-MIR841b

AccessionMI0014669 (change log)
DescriptionArabidopsis thaliana miR841b stem-loop
Gene family MIPF0001112; MIR841
Literature search

6 open access papers mention ath-MIR841b
(9 sentences)

Stem-loop
       c       cuaac         ca     c       u          c    aa   c     a       cg cc    g  g     cagu           ca          u       a     u    c       -c  u       -gc   a           a     cu           g          c     g          acaauaucaguauaaa       caaauuag 
5' uccu aucuccu     cgccaacug  aaugc uuggagu auccucuuca uuuc  auc uuguu guguuuu  g  aacu aa aaccu    aguuaggcauu  aggauugaag cguguag caaca cagu gcaccaa  ag accaugu   aga acucuggucuu aguug  ugugaauacga ccacuggaaa ugaaa aaacaaagaa                auuucau        a
   |||| |||||||     |||||||||  ||||| ||||||| |||||||||| ||||  ||| ||||| |||||||  |  |||| || |||||    |||||||||||  |||||||||| ||||||| ||||| |||| |||||||  || |||||||   ||| ||||||||||| |||||  ||||||||||| |||||||||| ||||| ||||||||||                |||||||         
3' agga uagagga     gugguugau  uuacg aaccuca uaggagaagu aaag  uag aacga cacaaag  u  uuga uu uugga    uuaauccguga  uccuaacuuc gcacauc guugu guua cgugguu  uc ugguaca   ucu ugagaucagaa ucaac  acacuuaugcu ggugaucuuu acuuu uuuguuucuu                uaaagua        c
       a       cgcua         ag     u       u          a    aa   u     a       au ca    g  a     uacu           aa          c       a     u    u       ca  -       aca   a           c     au           g          a     a          ----------------       aaaaacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 2184135-2184629 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR841b
ath-MIR3932achr4: 2179000-2179122 [+]
ath-MIR841bchr4: 2184135-2184629 [+]
Database links

Mature sequence ath-miR841b-5p

Accession MIMAT0017741
Previous IDsath-miR841b
Sequence

191 - 

uacgagccacuggaaacugaa

 - 211

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ath-miR841b-3p

Accession MIMAT0017742
Previous IDsath-miR841b*
Sequence

286 - 

caauuucuagugggucguauu

 - 306

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).