Stem-loop sequence ath-MIR774b

AccessionMI0014668 (change log)
DescriptionArabidopsis thaliana miR774b stem-loop
Gene family MIPF0001101; MIR774
Literature search

2 open access papers mention ath-MIR774b
(7 sentences)

Stem-loop
   gagu   gauuauau     -c                       ugaucaaugcuuacgauuuugguc 
5'     guu        ggauu  auuugagaugaagauauggguga                        a
       |||        |||||  |||||||||||||||||||||||                        a
3'     cga        ucuaa  uaagcucuacuuuuauaccuacu                        u
   uuug   -aaaaauu     uu                       uuuucuuaauuuaacgauuguauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 22150128-22150266 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR774b
ath-MIR859chr1: 22149718-22149843 [+]
ath-MIR774achr1: 22149936-22150033 [+]
ath-MIR774bchr1: 22150128-22150266 [+]
Database links

Mature sequence ath-miR774b-5p

Accession MIMAT0017739
Previous IDsath-miR774b
Sequence

25 - 

ugagaugaagauaugggugau

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ath-miR774b-3p

Accession MIMAT0017740
Previous IDsath-miR774b*
Sequence

97 - 

cauccauauuuucaucucgaa

 - 117

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).