Stem-loop sequence ath-MIR773b

AccessionMI0014666 (change log)
DescriptionArabidopsis thaliana miR773b stem-loop
Gene family MIPF0001106; MIR773
Literature search

4 open access papers mention ath-MIR773b
(10 sentences)

Stem-loop
      u     ug        cuca  ua           g             acuau         uaa  u   -      au    u  agaaa  c 
5' ggu gaagg  gcaauaac    aa  uaucagagggu uagauacucaacg     aggaggcaa   cu gag caaaca  ugau gc     uc a
   ||| |||||  ||||||||    ||  ||||||||||| |||||||||||||     |||||||||   || ||| ||||||  |||| ||     ||  
3' ucg uuucc  cguuguug    uu  auggucucuca aucugugaguugu     uccucuguu   ga cuu guuugu  acug cg     ag u
      c     gu        auac  gc           a             -ccau         uuc  c   a      cc    u  aaauc  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 13050667-13050864 [-]
intergenic
Database links

Mature sequence ath-miR773b-5p

Accession MIMAT0017735
Previous IDsath-miR773b*
Sequence

62 - 

ggcaauaacuugagcaaaca

 - 81

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ath-miR773b-3p

Accession MIMAT0017736
Previous IDsath-miR773b
Sequence

120 - 

uuugauuccagcuuuugucuc

 - 140

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).