Stem-loop sequence aly-MIR399i

AccessionMI0014638 (change log)
DescriptionArabidopsis lyrata miR399i stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
         -u      a a        a    a       -au  ---       u     u   uua 
5' gcaugg  uggauu c gggcaaau cucc uuggcag   ag   uuuucgu gcauc aua   u
   ||||||  |||||| | |||||||| |||| |||||||   ||   ||||||| ||||| |||    
3' cgugcc  acuuaa g cccguuua gagg aaccguc   uc   aaaagua uguag uau   u
         cu      c c        -    a       auu  uua       -     c   uag 
Get sequence
Deep sequencing
5 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 12888628-12888754 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR399i
aly-MIR399aGL348713.1: 12890901-12891062 [+]
aly-MIR399iGL348713.1: 12888628-12888754 [-]
aly-MIR399hGL348713.1: 12884715-12884820 [+]
aly-MIR399gGL348713.1: 12882529-12882685 [-]
Database links

Mature sequence aly-miR399i-5p

Accession MIMAT0017673
Previous IDsaly-miR399i*
Sequence

17 - 

gggcaaauacuccauuggcaga

 - 38

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR399i-3p

Accession MIMAT0017674
Previous IDsaly-miR399i
Sequence

92 - 

ugccaaaggagauuugccccg

 - 112

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2