Stem-loop sequence aly-MIR399h

AccessionMI0014637 (change log)
DescriptionArabidopsis lyrata miR399h stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
        a     a       a          ac      uu  c uu     cu 
5' auuac gggca gaucucu uuggcaggaa  cauuac  ga c  ugcau  c
   ||||| ||||| ||||||| ||||||||||  ||||||  || |  |||||   
3' uaaug cccgu uuagagg aaccguucuu  gugaug  uu g  acgua  u
        g     -       a          ga      -u  c uu     uu 
Get sequence
Deep sequencing
5 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 12884715-12884820 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR399h
aly-MIR399gGL348713.1: 12882529-12882685 [-]
aly-MIR399hGL348713.1: 12884715-12884820 [+]
aly-MIR399iGL348713.1: 12888628-12888754 [-]
aly-MIR399aGL348713.1: 12890901-12891062 [+]
Database links

Mature sequence aly-miR399h-5p

Accession MIMAT0017671
Previous IDsaly-miR399h*
Sequence

7 - 

gggcaagaucucuauuggcagg

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aly-miR399h-3p

Accession MIMAT0017672
Previous IDsaly-miR399h
Sequence

82 - 

ugccaaaggagauuugcccgg

 - 102

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1], Solid [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2