Stem-loop sequence aly-MIR399g

AccessionMI0014636 (change log)
DescriptionArabidopsis lyrata miR399g stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   -----gauga       -u gg   a a        a    a       auaguuuucgcuacaucuauauuauuuguuau 
5'           ugcaugg  u  auu c gggcaaau cucc uuggcag                                u
             |||||||  |  ||| | |||||||| |||| |||||||                                 
3'           acguacc  g  uaa g cccguuua gagg aaccguc                                a
   cuacaagaaa       uu uu   c c        -    a       auuucauaaaaaguauguaacuaaguggguau 
Get sequence
Deep sequencing
5 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 12882529-12882685 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR399g
aly-MIR399aGL348713.1: 12890901-12891062 [+]
aly-MIR399iGL348713.1: 12888628-12888754 [-]
aly-MIR399hGL348713.1: 12884715-12884820 [+]
aly-MIR399gGL348713.1: 12882529-12882685 [-]
Database links

Mature sequence aly-miR399g-5p

Accession MIMAT0017669
Previous IDsaly-miR399g*
Sequence

23 - 

gggcaaauacuccauuggcaga

 - 44

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR399g-3p

Accession MIMAT0017670
Previous IDsaly-miR399g
Sequence

111 - 

ugccaaaggagauuugccccg

 - 131

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2