Stem-loop sequence aly-MIR399c

AccessionMI0014590 (change log)
DescriptionArabidopsis lyrata miR399c stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
           - c   a        u      a        a   uc     uuu  aucuuuu 
5' uaagcgga g agu auagggca cuuucu uuggcagg gac  ggcua   gu       g
   |||||||| | ||| |||||||| |||||| |||||||| |||  |||||   ||        
3' auucgccu c uca ugucccgu gagagg aaccguuc cug  ucggu   cg       u
           u a   c        u      a        a   ua     uau  guucuug 
Get sequence
Deep sequencing
14 reads, 300 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 20345020-20345144 [+]
intergenic
Database links

Mature sequence aly-miR399c-5p

Accession MIMAT0017575
Previous IDsaly-miR399c*
Sequence

18 - 

gggcaucuuucuauuggcagg

 - 38

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR399c-3p

Accession MIMAT0017576
Previous IDsaly-miR399c
Sequence

89 - 

ugccaaaggagaguugcccug

 - 109

Get sequence
Deep sequencing8 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2