Stem-loop sequence aly-MIR396b

AccessionMI0014582 (change log)
DescriptionArabidopsis lyrata miR396b stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
      ga  aa  ag         ----     a                    a   u      ca      uuguuuuuuuuuuucuaaaccaaa 
5' gaa  ag  ga  aagauccug    gucau uuuuuccacagcuuucuuga cuu cuuuuu  uuucca                        a
   |||  ||  ||  |||||||||    ||||| |||||||||||||||||||| ||| ||||||  ||||||                        a
3' cuu  uu  cu  uuuugggac    cagua aaaagggugucgaaagaacu gaa gaagaa  aaaggu                        a
      ag  ac  ca         uuaa     c                    c   -      ac      uuuacgauuuaaaaucucuagaaa 
Get sequence
Deep sequencing
1123 reads, 3.64e+04 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 18203535-18203722 [+]
intergenic
Database links

Mature sequence aly-miR396b-5p

Accession MIMAT0017559
Previous IDsaly-miR396b
Sequence

32 - 

uuccacagcuuucuugaacuu

 - 52

Get sequence
Deep sequencing751 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR396b-3p

Accession MIMAT0017560
Previous IDsaly-miR396b*
Sequence

135 - 

gcucaagaaagcugugggaaa

 - 155

Get sequence
Deep sequencing372 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2