Stem-loop sequence aly-MIR395c

Accession

MI0014577

Description

Arabidopsis lyrata miR395c stem-loop

Gene family

MIPF0000016; MIR395

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Stem-loop

    ca -      aagaagaaa    -    u u   u         uu         u     -    -------    acu        u 
auga  g agcuac         guca aaug c uca gaguucccu  aacgcuuca uguua auau       ucaa   acauuuau u
||||  | ||||||         |||| |||| | ||| |||||||||  ||||||||| ||||| ||||       ||||   ||||||||  
uauu  c uugaug         cggu uuac g ggu uucaggggg  uugugaagu acaau uaug       aguu   uguaaaua c
    ag a      ---------    c    u u   u         gu         c     a    uuuagcu    ---        c 

Mature sequence aly-miR395c-5p

• Accession: MIMAT0017549
• Previous IDs: aly-miR395c*
• Sequence: 40 - guucccuuuaacgcuucauug - 60
• Evidence: experimental; Solexa [1]

Mature sequence aly-miR395c-3p

• Accession: MIMAT0017550
• Previous IDs: aly-miR395c
• Sequence: 116 - cugaaguguuuggggggacuu - 136
• Evidence: experimental; Solexa [1]

References

1. PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).