Stem-loop sequence aly-MIR172b

Accession

MI0014564

Description

Arabidopsis lyrata miR172b stem-loop

Gene family

MIPF0000035; MIR172

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-172_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The mir-172 microRNA is thought to target mRNAs coding for APETALA2-like transcription factors. It has been verified experimentally in the model plant, Arabidopsis thaliana (mouse-ear cress). The mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

     ---------caucu       u    a         c           a    aaa  uga    u u      
uagcu              gucguug uugu ggugcagca caucaagauuc caug   au   uaaa c ccuaa 
|||||              ||||||| |||| ||||||||| ||||||||||| ||||   ||   |||| | |||| a
gucga              cggcagc aaca cuacgucgu guaguucuaag guau   ua   guuu g ggauu 
     aauccauaaaacau       u    a         a           a    aug  -ua    u -      

Deep sequencing

2770 reads, 1 experiments

Mature sequence aly-miR172b-5p

• Accession: MIMAT0017523
• Previous IDs: aly-miR172b*
• Sequence: 27 - gcagcaccaucaagauucaca - 47
• Deep sequencing: 20 reads, 1 experiments
• Evidence: experimental; Solexa [1], SOLiD [2]

Mature sequence aly-miR172b-3p

• Accession: MIMAT0017524
• Previous IDs: aly-miR172b
• Sequence: 93 - agaaucuugaugaugcugcau - 113
• Deep sequencing: 2750 reads, 1 experiments
• Evidence: experimental; Solexa [1], SOLiD [2]

References

1. PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2. PMID:20407023 "Arabidopsis lyrata small RNAs: transient MIRNA and small interfering RNA loci within the Arabidopsis genus" Ma Z, Coruh C, Axtell MJ Plant Cell. 22:1090-1103(2010).