Stem-loop sequence aly-MIR169e

Accession MI0014549
Description Arabidopsis lyrata miR169e stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
   acuaau      a      c   -   g     aau      u     u         a          aauu     aca    uc 
guc      uguauc uagagu uug cau gaaaa   agagaa gagau gagccaagg ugacuugccg    uauua   aauc  a
|||      |||||| |||||| ||| ||| |||||   |||||| ||||| ||||||||| ||||||||||    |||||   ||||   
uag      auauag aucuca aac gua cuuuu   ucucuu cuuug cucgguucc guugaacggc    guggu   uuag  a
   cuaacu      -      -   u   g     -cu      c     u         a          --cc     --a    ua 
Get sequence
Deep sequencing
76 reads, 3.16e+03 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
GL348713.1: 28728962-28729135 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR169e
aly-MIR169d GL348713.1: 28725944-28726098 [-]
aly-MIR169e GL348713.1: 28728962-28729135 [+]

Mature sequence aly-miR169e-5p

Accession MIMAT0017493
Previous IDs aly-miR169e
Sequence

51 - 

ugagccaaggaugacuugccg

 - 71

Get sequence
Deep sequencing 61 reads, 1 experiments
Evidence experimental; SOLiD [20407023], Solexa [20407027]

Mature sequence aly-miR169e-3p

Accession MIMAT0017494
Previous IDs aly-miR169e*
Sequence

108 - 

gcaaguugaccuuggcucugu

 - 128

Get sequence
Deep sequencing 15 reads, 1 experiments
Evidence experimental; SOLiD [20407023], Solexa [20407027]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2