Stem-loop sequence aly-MIR169e

AccessionMI0014549
DescriptionArabidopsis lyrata miR169e stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
   acuaau      a      c   -   g     aau      u     u         a          aauu     aca    uc 
guc      uguauc uagagu uug cau gaaaa   agagaa gagau gagccaagg ugacuugccg    uauua   aauc  a
|||      |||||| |||||| ||| ||| |||||   |||||| ||||| ||||||||| ||||||||||    |||||   ||||   
uag      auauag aucuca aac gua cuuuu   ucucuu cuuug cucgguucc guugaacggc    guggu   uuag  a
   cuaacu      -      -   u   g     -cu      c     u         a          --cc     --a    ua 
Get sequence
Deep sequencing
76 reads, 3.16e+03 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
GL348713.1: 28728962-28729135 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR169e
aly-MIR169dGL348713.1: 28725944-28726098 [-]
aly-MIR169eGL348713.1: 28728962-28729135 [+]

Mature sequence aly-miR169e-5p

Accession MIMAT0017493
Previous IDsaly-miR169e
Sequence

51 - 

ugagccaaggaugacuugccg

 - 71

Get sequence
Deep sequencing18 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR169e-3p

Accession MIMAT0017494
Previous IDsaly-miR169e*
Sequence

108 - 

gcaaguugaccuuggcucugu

 - 128

Get sequence
Deep sequencing13 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2