Stem-loop sequence aly-MIR169c

DescriptionArabidopsis lyrata miR169c stem-loop
Gene family MIPF0000037; MIR169_2
  c     ua      u     -u     aa    cauu     uc     ag             --ua       auauuuacucuauauucgguuuauauuauggagauuaugcuuuauauauauauauacauaguuuuaauuga 
gu ucauc  aagccu gaaug  gggaa  aggc    guugu  agcca  gaugacuugccgg    gcuuugu                                                                       u
|| |||||  |||||| |||||  |||||  ||||    |||||  |||||  |||||||||||||    |||||||                                                                       u
ca aguag  uucgga cuuac  uccuu  uccg    caacg  ucggu  cuacugaacggcc    cgaaaca                                                                       u
  c     ca      u     uc     -c    ---u     ua     cu             cgaa       aauguguagagugguuguguguauauuuauucauuuaugaaaaagcauaaucuaaugcaugcaugcuuuuu 
Get sequence
Deep sequencing
68 reads, 2.83e+03 reads per million, 1 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
GL348719.1: 23073353-23073644 [+]

Mature sequence aly-miR169c-5p

Accession MIMAT0017489
Previous IDsaly-miR169c

45 - 


 - 65

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR169c-3p

Accession MIMAT0017490
Previous IDsaly-miR169c*

233 - 


 - 253

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]


PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).