|
miRBase |
|
Stem-loop sequence aly-MIR167a |
|||
| Accession | MI0014539 | ||
| Description | Arabidopsis lyrata miR167a stem-loop | ||
| Gene family | MIPF0000023; MIR167_1 | ||
| Stem-loop |
ac - u u a c - - - a u ggugc cgg ca c g ugaagcugc agcaugaucuaauu ag cuu ucuuu ua cuguuguugugu ||||| ||| || | | ||||||||| |||||||||||||| || ||| ||||| || ||||||||||| u ccacg guc gu g c acuuugacg uuguacuagauuag uc gag agaga au gguagcaauacu cu a u c c c c u u - u |
||
| Deep sequencing |
| ||
Mature sequence aly-miR167a-5p |
|
| Accession | MIMAT0017473 |
| Previous IDs | aly-miR167a |
| Sequence |
18 - ugaagcugccagcaugaucua - 38 |
| Deep sequencing | 3166 reads, 1 experiments |
| Evidence | experimental; Solexa [1], SOLiD [2] |
Mature sequence aly-miR167a-3p |
|
| Accession | MIMAT0017474 |
| Previous IDs | aly-miR167a* |
| Sequence |
102 - gaucauguucgcaguuucacc - 122 |
| Deep sequencing | 44 reads, 1 experiments |
| Evidence | experimental; Solexa [1], SOLiD [2] |
References |
|
| 1 |
PMID:20407027
"MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana"
Plant Cell. 22:1074-1089(2010).
|
| 2 |
PMID:20407023
"Arabidopsis lyrata small RNAs: transient MIRNA and small interfering RNA loci within the Arabidopsis genus"
Plant Cell. 22:1090-1103(2010).
|