Stem-loop sequence aly-MIR156h

AccessionMI0014509
DescriptionArabidopsis lyrata miR156h stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -gaa   u  a      -            -a     g uua      ag 
5'     aug ug cagaag aaagagagcaca  ccugg a   gcaaaa  a
       ||| || |||||| ||||||||||||  ||||| |   ||||||   
3'     uac ac gucuuc uuucucucgugu  gggcu u   cguuuu  u
   cuac   c  c      c            ga     g ucc      ga 
Get sequence
Deep sequencing
183 reads, 7.62e+03 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
GL348720.1: 17184369-17184467 [-]
intergenic

Mature sequence aly-miR156h-5p

Accession MIMAT0017411
Previous IDsaly-miR156h
Sequence

8 - 

ugacagaagaaagagagcac

 - 27

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR156h-3p

Accession MIMAT0017412
Previous IDsaly-miR156h*
Sequence

73 - 

gcucucuuuccuucugccacc

 - 93

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2