Stem-loop sequence aly-MIR156g

AccessionMI0014508
DescriptionArabidopsis lyrata miR156g stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        u   u  u   uaacaaua    a  c    -               a  u    ccuuu   u     g 
5' ggagg aag ga gaa        agga gg gaca gaagagagugagcac ca ggcu     uuc agcau c
   ||||| ||| || |||        |||| || |||| ||||||||||||||| || ||||     ||| |||||  
3' ucucu uuc cu cuu        uccu cc cugu cuucucucauucgug gu ucga     aag ucgua u
        -   u  -   -----ucg    -  u    u               c  c    -----   c     c 
Get sequence
Deep sequencing
138 reads, 5.74e+03 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
GL348715.1: 21084413-21084550 [+]
intergenic

Mature sequence aly-miR156g-5p

Accession MIMAT0017409
Previous IDsaly-miR156g
Sequence

32 - 

cgacagaagagagugagcac

 - 51

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence aly-miR156g-3p

Accession MIMAT0017410
Previous IDsaly-miR156g*
Sequence

97 - 

gcuuacucucuucuugucucc

 - 117

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).