Stem-loop sequence bta-mir-3432a-1

AccessionMI0014500 (change log)
Previous IDsbta-mir-3432-1
DescriptionBos taurus miR-3432a-1 stem-loop
Gene family MIPF0001187; mir-3432
Literature search

3 open access papers mention bta-mir-3432a-1
(4 sentences)

Stem-loop
   -c           -      ugu  g       --u     ug -  u ca 
5'   uucgaucuuug ucaugg   gc ggaucuu   aguug  g ug g  a
     ||||||||||| ||||||   || |||||||   |||||  | || |   
3'   agguuaggaac aguacc   ug ccuaggg   ucgac  u ac c  a
   cc           c      --u  a       ugu     gu g  u uc 
Get sequence
Deep sequencing
4698 reads, 11.8 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Jin et al. predicted this miRNA bioinformatically in [1], and validated its expression by qPCR in [2].

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 55992009-55992105 [-]
sense
ENSBTAT00000028388 ; TP53BP1-201; intron 3
Database links

Mature sequence bta-miR-3432a

Accession MIMAT0017396
Previous IDsbta-miR-3432
Sequence

21 - 

ugcgggaucuuuaguuguggug

 - 42

Get sequence
Deep sequencing9409 reads, 68 experiments
Evidence experimental; qPCR [2], Illumina [3]
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2