Stem-loop sequence bta-mir-3431

AccessionMI0014498 (change log)
DescriptionBos taurus miR-3431 stem-loop
Gene family MIPF0002046; mir-3431
Literature search

5 open access papers mention bta-mir-3431
(10 sentences)

Stem-loop
   auacccaa    u c     cc        -    g       -au   c 
5'         ugaa g gaaaa  ucagucag ccuu uggaugu   guu u
           |||| | |||||  |||||||| |||| |||||||   ||| g
3'         acuu c cuuuu  agucaguc ggag aucuaca   cag c
   ---aaucg    u a     aa        a    -       guc   a 
Get sequence
Deep sequencing
8333 reads, 4.41 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Jin et al. predicted this miRNA bioinformatically in [1], and validated its expression by qPCR in [2].

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 34879430-34879526 [-]
sense
ENSBTAT00000065531 ; GABRE-201; intron 6
ENSBTAT00000018017 ; GABRE-202; intron 6
Clustered miRNAs
< 10kb from bta-mir-3431
bta-mir-452chrX: 34882394-34882478 [-]
bta-mir-224chrX: 34881360-34881440 [-]
bta-mir-3431chrX: 34879430-34879526 [-]
Database links

Mature sequence bta-miR-3431

Accession MIMAT0017394
Sequence

21 - 

ccucagucagccuuguggaugu

 - 42

Get sequence
Deep sequencing5336 reads, 67 experiments
Evidence experimental; qPCR [2], Illumina [3]
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2
3
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).