Stem-loop sequence bta-mir-2284w

AccessionMI0014497 (change log)
DescriptionBos taurus miR-2284w stem-loop
Gene family MIPF0000747; mir-2284
Literature search

14 open access papers mention bta-mir-2284w
(33 sentences)

Stem-loop
   uuu   -u               -     ug  c      c  c   a 
5'    caa  uauuggguuggccaa gaguu  uu ggguuu uc aua g
      |||  ||||||||||||||| |||||  || |||||| || ||| c
3'    guu  auaacccaaccgguu cucaa  aa uccaaa ag uau u
   -uc   uu               u     gu  c      a  a   g 
Get sequence
Deep sequencing
5873 reads, 18.8 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Jin et al. predicted this miRNA bioinformatically in [1], and validated its expression by qPCR in [2].

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 2676325-2676420 [+]
sense
ENSBTAT00000008444 ; DOCK11-201; intron 23
Database links

Mature sequence bta-miR-2284w

Accession MIMAT0017393
Sequence

21 - 

aagaguuuguucggguuucuc

 - 41

Get sequence
Deep sequencing1034 reads, 64 experiments
Evidence experimental; qPCR [2], Illumina [3]
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2
3
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).