Stem-loop sequence bmo-mir-989b

AccessionMI0014484
DescriptionBombyx mori miR-989b stem-loop
Stem-loop
   c   ac     acu        ac   -------------        -a    aac     gc     
5'  acu  augua   ugugacgu  agu             gugaugug  cgug   aagua  gacc 
    |||  |||||   ||||||||  |||             ||||||||  ||||   |||||  ||| a
3'  uga  ugcau   gcacugua  uca             uauuauac  gcac   uuuau  cuga 
   a   ca     -au        au   gcuucucaauucu        ga    cau     -a     
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2828: 2818959-2819079 [-]
intergenic

Mature sequence bmo-miR-989b

Accession MIMAT0015627
Sequence

26 - 

gugugaugugacgugaacaag

 - 46

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).