Stem-loop sequence bmo-mir-2733i

AccessionMI0014452 (change log)
DescriptionBombyx mori miR-2733i stem-loop
Gene family MIPF0000766; mir-2733
Literature search

1 open access papers mention bmo-mir-2733i
(4 sentences)

Stem-loop
   ----ac  u  c   a u       aau      ug    -    u   a     uua 
5'       gu gu uac g gucuguu   aauagu  uuac uucc cag ugaca   u
         || || ||| | |||||||   ||||||  |||| |||| ||| |||||    
3'       cg ca aug c cagacaa   uuauca  aaug aagg guc acugu   a
   gccaaa  u  -   - -       cuu      gu    u    -   -     uau 
Get sequence
Deep sequencing
22 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581684.1: 344891-344998 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2733i
bmo-mir-9dNW_004581684.1: 354559-354643 [-]
bmo-mir-2733cNW_004581684.1: 353724-353805 [-]
bmo-mir-2733gNW_004581684.1: 347847-347958 [-]
bmo-mir-2733a-1NW_004581684.1: 347677-347760 [-]
bmo-mir-2851-1NW_004581684.1: 347670-347768 [+]
bmo-mir-2733b-2NW_004581684.1: 347220-347348 [-]
bmo-mir-2733hNW_004581684.1: 347062-347142 [-]
bmo-mir-2733b-1NW_004581684.1: 346939-347018 [-]
bmo-mir-2733a-3NW_004581684.1: 346598-346745 [-]
bmo-mir-2851-2NW_004581684.1: 346562-346660 [+]
bmo-mir-2733a-2NW_004581684.1: 346489-346605 [-]
bmo-mir-2733fNW_004581684.1: 346080-346197 [-]
bmo-mir-2733iNW_004581684.1: 344891-344998 [-]
bmo-mir-2733e-1NW_004581684.1: 342896-342993 [-]
bmo-mir-2733e-2NW_004581684.1: 342566-342664 [-]
Database links

Mature sequence bmo-miR-2733i-5p

Accession MIMAT0015591
Previous IDsbmo-miR-2733i*
Sequence

28 - 

aguuguuacuuccucagauga

 - 48

Get sequence
Evidence experimental; SOLID [1]

Mature sequence bmo-miR-2733i-3p

Accession MIMAT0015592
Previous IDsbmo-miR-2733i
Sequence

61 - 

ucacugggaauguaaugacuau

 - 82

Get sequence
Deep sequencing21 reads, 2 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).