Stem-loop sequence bmo-mir-3384

AccessionMI0014445 (change log)
DescriptionBombyx mori miR-3384 stem-loop
Literature search

1 open access papers mention bmo-mir-3384
(2 sentences)

Stem-loop
   au     -  -   c    u     --u         --  u       ----       c   --u u u 
5'   gaaau gu guc ucua ccggc   cgaauggac  ca gaaaugu    acacgac cgg   c g a
     ||||| || ||| |||| |||||   |||||||||  || |||||||    ||||||| |||   | | u
3'   cuuug cg cag agau ggucg   guuugucug  gu uuuuaua    ugugcug gcc   g c g
   -u     u  g   a    -     cgu         uc  c       auaa       a   uuu u g 
Get sequence
Deep sequencing
77 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582011.1: 8190596-8190726 [-]
intergenic
NW_004582015.1: 1484894-1485024 [-]
intergenic
NW_004601999.1: 28-158 [+]
intergenic
NW_004602653.1: 356-486 [-]
intergenic
NW_004619548.1: 392-522 [+]
intergenic
Database links

Mature sequence bmo-miR-3384-5p

Accession MIMAT0015579
Previous IDsbmo-miR-3384*
Sequence

2 - 

ugaaauguguccucuauccggcuc

 - 25

Get sequence
Deep sequencing18 reads, 3 experiments
Evidence experimental; SOLID [1]
Database links

Mature sequence bmo-miR-3384-3p

Accession MIMAT0015580
Previous IDsbmo-miR-3384
Sequence

96 - 

ugucuguuugugcgcugguagaaga

 - 120

Get sequence
Deep sequencing56 reads, 3 experiments
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).