Stem-loop sequence bmo-mir-2733j

AccessionMI0014412 (change log)
DescriptionBombyx mori miR-2733j stem-loop
Gene family MIPF0000766; mir-2733
Literature search

1 open access papers mention bmo-mir-2733j
(4 sentences)

Stem-loop
   ----cuucuauauc        au  a        a u      u    -u     
5'               ucucucua  gc gucaucau c cucagu gaua  gugu 
                 ||||||||  || |||||||| | |||||| ||||  ||| a
3'               agagagau  ug uaguagua g ggguca cuau  uaca 
   cgcacuacacuacu        gg  c        c u      -    cu     
Get sequence
Deep sequencing
14 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bmo-miR-2733j

Accession MIMAT0015539
Sequence

23 - 

agucaucauacucucaguugaua

 - 45

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).