Stem-loop sequence bmo-mir-3338

AccessionMI0014396 (change log)
DescriptionBombyx mori miR-3338 stem-loop
Gene family MIPF0001449; mir-3338
Stem-loop
   acc    ga  au    c  c   a        c     u     a   uaaa  c 
5'    aagu  ca  agag gu uca agcaaaca aguag gugca ugc    gu c
      ||||  ||  |||| || ||| |||||||| ||||| ||||| |||    ||  
3'    uucg  gu  ucuc ca agu uuguuugu ucauu caugu acg    ca u
   --c    -a  au    a  u   c        u     -     -   --ug  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582013.1: 6563758-6563864 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-3338
bmo-mir-3338NW_004582013.1: 6563758-6563864 [-]
bmo-mir-3327NW_004582013.1: 6563612-6563716 [-]
Database links

Mature sequence bmo-miR-3338-5p

Accession MIMAT0015525
Previous IDsbmo-miR-3338*
Sequence

26 - 

agcaaacacaguagugugcaa

 - 46

Get sequence
Evidence experimental; SOLID [1]

Mature sequence bmo-miR-3338-3p

Accession MIMAT0015526
Previous IDsbmo-miR-3338
Sequence

66 - 

auguacuuacuuuguuuguucu

 - 87

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).