Stem-loop sequence bmo-mir-3338

AccessionMI0014396
DescriptionBombyx mori miR-3338 stem-loop
Gene family MIPF0001449; mir-3338
Stem-loop
   acc    ga  au    c  c   a        c     u     a   uaaa  c 
5'    aagu  ca  agag gu uca agcaaaca aguag gugca ugc    gu c
      ||||  ||  |||| || ||| |||||||| ||||| ||||| |||    ||  
3'    uucg  gu  ucuc ca agu uuguuugu ucauu caugu acg    ca u
   --c    -a  au    a  u   c        u     -     -   --ug  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2993: 6549898-6550004 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-3338
bmo-mir-3338nscaf2993: 6549898-6550004 [-]
bmo-mir-3327nscaf2993: 6549752-6549856 [-]

Mature sequence bmo-miR-3338-5p

Accession MIMAT0015525
Previous IDsbmo-miR-3338*
Sequence

26 - 

agcaaacacaguagugugcaa

 - 46

Get sequence
Evidence experimental; SOLID [1]

Mature sequence bmo-miR-3338-3p

Accession MIMAT0015526
Previous IDsbmo-miR-3338
Sequence

66 - 

auguacuuacuuuguuuguucu

 - 87

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).