Stem-loop sequence bmo-mir-3327

AccessionMI0014385
DescriptionBombyx mori miR-3327 stem-loop
Gene family MIPF0001547; mir-3327
Stem-loop
   ---a  acauuuu       guauaa                   c  uauac 
5'     ga       ggguaau      acaacaggaauguuaugua ag     a
       ||       |||||||      ||||||||||||||||||| ||     g
3'     cu       cucauua      uguuguuuuugcaauguau uc     a
   ucaa  ccaucau       -aaucc                   a  uuaau 
Get sequence
Deep sequencing
1 reads, 0.7 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2993: 6549752-6549856 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-3327
bmo-mir-3338nscaf2993: 6549898-6550004 [-]
bmo-mir-3327nscaf2993: 6549752-6549856 [-]

Mature sequence bmo-miR-3327-5p

Accession MIMAT0015514
Previous IDsbmo-miR-3327
Sequence

23 - 

aacaacaggaauguuauguac

 - 43

Get sequence
Evidence experimental; SOLID [1]

Mature sequence bmo-miR-3327-3p

Accession MIMAT0015515
Previous IDsbmo-miR-3327*
Sequence

61 - 

auauguaacguuuuuguuguccu

 - 83

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).