Stem-loop sequence bmo-mir-3317

AccessionMI0014375 (change log)
DescriptionBombyx mori miR-3317 stem-loop
Stem-loop
   aau    gaa  -     -g  u        -a     aaaacucau   -  gaaauuc       ccga      ug 
5'    cguu   ag guuug  gc gcauuucu  agacc         ucg cg       auauaga    acggcg  a
      ||||   || |||||  || ||||||||  |||||         ||| ||       |||||||    ||||||  u
3'    gcag   uc cgaau  ug uguaagga  uuugg         ggc gc       uguaucu    ugccgu  a
   --u    acg  u     ag  u        ca     ---------   u  -------       cuuc      ua 
Get sequence
Deep sequencing
110 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581704.1: 1850755-1850893 [+]
intergenic
NW_004581767.1: 583223-583361 [-]
intergenic
NW_004596765.1: 162-300 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-3317
bmo-mir-2832NW_004581704.1: 1849214-1849311 [-]
bmo-mir-3317NW_004581704.1: 1850755-1850893 [+]
Database links

Mature sequence bmo-miR-3317

Accession MIMAT0015505
Sequence

108 - 

uacaggaauguugugauaagcucug

 - 132

Get sequence
Deep sequencing31 reads, 3 experiments
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).