Stem-loop sequence bmo-mir-3297

AccessionMI0014354 (change log)
DescriptionBombyx mori miR-3297 stem-loop
Stem-loop
   uua    uaac    a  gccuag  c    -     a        ---   gc   ccau      c    cc 
5'    guua    gaca uu      ca aucu aguca aaauauug   gag  aaa    cuggac uggg  u
      ||||    |||| ||      || |||| ||||| ||||||||   |||  |||    |||||| ||||   
3'    caau    uugu ag      gu ugga ucagu uuuauaac   uuc  uuu    gaucug auuu  u
   --g    ----    g  --acua  a    c     c        gua   aa   uuuu      a    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582057.1: 11225-11362 [+]
intergenic
NW_004582057.1: 13038-13175 [+]
intergenic
Database links

Mature sequence bmo-miR-3297-5p

Accession MIMAT0015485
Previous IDsbmo-miR-3297
Sequence

24 - 

gcacaucuagucaaaaauauuggag

 - 48

Get sequence
Evidence experimental; SOLID [1]

Mature sequence bmo-miR-3297-3p

Accession MIMAT0015486
Previous IDsbmo-miR-3297*
Sequence

92 - 

uaacuuaugcaauauuucugacuca

 - 116

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).