Stem-loop sequence bmo-mir-3245

AccessionMI0014300 (change log)
DescriptionBombyx mori miR-3245 stem-loop
Literature search

1 open access papers mention bmo-mir-3245
(1 sentences)

Stem-loop
   ga ga   -    g     uu     -       u    ucca u    -----      a 
5'   c  agg uguu uuccg  gguga uggugag ccag    g cgcg     ggaaga a
     |  ||| |||| |||||  ||||| ||||||| ||||    | ||||     |||||| c
3'   g  ucc gcag agggu  ucacu aucacuu gguu    c gugu     ccuuuu a
   -a gg   u    -     --     g       -    -uca u    uuuca      c 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581689.1: 1797493-1797604 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-3245
bmo-mir-2810NW_004581689.1: 1792245-1792317 [+]
bmo-mir-3245NW_004581689.1: 1797493-1797604 [+]
Database links

Mature sequence bmo-miR-3245

Accession MIMAT0015427
Sequence

88 - 

uagucacuugggagacguccugg

 - 110

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).