Stem-loop sequence bmo-mir-3228

AccessionMI0014282 (change log)
DescriptionBombyx mori miR-3228 stem-loop
Literature search

1 open access papers mention bmo-mir-3228
(1 sentences)

Stem-loop
   uauuu  gca    g ga    ---   -uu   - --u  u       u    u   -  a 
5'      ga   ccuu a  ucaa   aug   gcu g   cc uggaucu gaag ucu ga u
        ||   |||| |  ||||   |||   ||| |   || ||||||| |||| ||| ||  
3'      cu   ggag u  aguu   uac   cga c   gg gcuuaga cuuc aga cu u
   ----u  -aa    g ag    cau   ugu   g uuc  u       -    u   a  u 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581785.1: 199374-199485 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-3228
bmo-mir-3228NW_004581785.1: 199374-199485 [+]
bmo-mir-3229NW_004581785.1: 203938-204075 [+]
Database links

Mature sequence bmo-miR-3228

Accession MIMAT0015410
Sequence

15 - 

gagaucaaauguugcuguccuugga

 - 39

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).