Stem-loop sequence bmo-mir-279e

AccessionMI0014278 (change log)
DescriptionBombyx mori miR-279e stem-loop
Literature search

8 open access papers mention bmo-mir-279e
(13 sentences)

Stem-loop
   ua   uc      auucuaauc    guua    aaua       gau  g    caa 
5'   guu  gagauu         agcu    ggag    guguugc   gu uacu   u
     |||  ||||||         ||||    ||||    |||||||   || ||||   u
3'   caa  uucugg         ucgg    ccuc    cauagcg   ca guga   u
   -a   -u      --gcucgcc    ----    ---a       -au  -    uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582009.1: 6127664-6127769 [-]
intergenic
Database links

Mature sequence bmo-miR-279e

Accession MIMAT0015406
Sequence

67 - 

ugacuagcgauacacuccggcu

 - 88

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).