Stem-loop sequence hsa-mir-1273d

Accession MI0014254
Description Homo sapiens miR-1273d stem-loop
Gene family MIPF0000579; mir-1273
Stem-loop 
---gaa      ---ga     uga        c       a  - aa 
      ucgcuu     accca   gguugagg ugcagug gc c  g
      ||||||     |||||   |||||||| ||||||| || |   
      agcgag     ugggu   ccgacuuc acgucac cg g  a
cuucaa      aacag     ---        -       -  u cu
Get sequence
Deep sequencing
63 reads, 16 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 10287776-10287861 [+]
sense
OTTHUMT00000005102 ; KIF1B-001; intron 1
OTTHUMT00000005103 ; KIF1B-002; intron 1
OTTHUMT00000005104 ; KIF1B-003; intron 1
OTTHUMT00000005102 ; KIF1B-001; intron 1
OTTHUMT00000005103 ; KIF1B-002; intron 1
OTTHUMT00000005104 ; KIF1B-003; intron 1
OTTHUMT00000005102 ; KIF1B-001; intron 1
OTTHUMT00000005103 ; KIF1B-002; intron 1
OTTHUMT00000005104 ; KIF1B-003; intron 1
ENST00000263934 ; KIF1B-002; intron 1
ENST00000377093 ; KIF1B-003; intron 1
ENST00000377086 ; KIF1B-001; intron 1
ENST00000355249 ; KIF1B-201; intron 1
ENST00000263934 ; KIF1B-002; intron 1
ENST00000377093 ; KIF1B-003; intron 1
ENST00000377086 ; KIF1B-001; intron 1
ENST00000355249 ; KIF1B-201; intron 1
ENST00000263934 ; KIF1B-002; intron 1
ENST00000377093 ; KIF1B-003; intron 1
ENST00000377086 ; KIF1B-001; intron 1
Database links

Mature sequence hsa-miR-1273d

Accession MIMAT0015090
Sequence

10 -  

gaacccaugagguugaggcugcagu

 - 34

Get sequence
Deep sequencing 28 reads, 6 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).